Molecular study on Efflux pumps of Klebsiella pneumonia Isolated from patients with Cystitis
Biology Department, College of Science, University of Babylon, Iraq.
*Corresponding Author E-mail: amersahar575@gmail.com, dr.dahmoshi83@gmail.com
ABSTRACT:
Background: Klebsiella pneumoniae can be defined as one of the clinically relevant pathogens that is a common cause of community-acquired and hospital-acquired urinary tract infections (UTI). Objective: The current study was conducted to investigate most common members of 5 classes of efflux pumps among K. Pneumonia isolates. Methodology: K. Pneumonia isolates was diagnosed on EMB and confirmed by tyrB gene. Antibiotic susceptibility test has been done based on the CLSI-2019. Efflux pumps genes were examined via PCR. Results: All isolates were high resist to ceftazidime, Amoxicillin, cefotaxime, ceftriaxone, Cefixime, cefepime, streptomycin and trimethoprime. Moderate resistance were showed to nitrofurantion, Aztreonam, Kanamycin, Cefoxitin, Gentamycine and Tobramycine. Low resistance was exhibited to Ciprofloxacine, Azithromycin, Doxycycline, piperacillin, Nalidixic acid, Imipenem and Amikacine. High sensitivity were exploited to Levofloxacine, ofloxacine, Meropenem and Netilamicin Concern antibiotic resistance patterns PDR, XDR and MDR), the results revealed that (10%) isolates were non-MDR while MDR compile (90%). Results of molecular investigation of efflux pumps in K pneumonia revealed that, AcrAB-TolC, AcrAD-TolC and AcrFE-TolC genes, EmrAB-TolC, EmrD and MdfA, EmrE, YnfA and TehA, MacAB-TolC and MdlAB-TolC, MdtK and DinF) genes were investigated for K. pneumoniae. Results of biofilm formation revealed that 100% were biofilm former (40% weak biofilm, 44% moderate and 16% strong biofilm former). Conclusion: The study concludes that, all efflux pumps may be highly associated with resistance to penicillins and cephalosporins and moderately with streptomycin, trimethoprime, nitrofuraniton, Aztreonam, Kanamycin. Additionally, biofilm formation was highly related to presence of studied pumps.
KEYWORDS: UTIs, Drug resistance, Klebsiella pneumoniae, MDR, Efflux pump.
INTRODUCTION:
Worldwide, one of the major bacterial diseases influencing the existences of 150-million- man yearly is the UTI, which can be complicated or uncomplicated. Typically, the latter affect people who are healthy and have no neurological or structural urinary tract abnormalities1,2. Upper UTIs pyelonephritis) and lower UTIs cystitis) are the two types of such infections. On the other hand, urinary retention resulted from neurological diseases, urinary obstruction, renal failure, pregnancy, renal transplantation, immunosuppression, and the existence of foreign bodies like indwelling catheters, calculi, or other drainage devices are all examples of the former3,4.
According to Bao 20205, a 63-year-old female patient developed a recurrent UTI with extensive drug resistance K. pneumoniae ERkp). The pathogen responsible for UTIs was identified as ERKp, which was resistant to all antibiotics tested apart from polymyxin B and tigecycline. The patient's clinical history incorporated a long history of hypertension and type-2 diabetes. The major facilitator superfamily MFS), ATP binding cassette ABC) superfamily, the small multidrug resistance SMR) family, the Multidrug and toxic- compound extrusion MATE) family, and the resistance nodulation division RND) family are the five families of efflux pump systems. The arrangement of biofilms, joined with possessing of efflux siphons, lessens bacterial anti-toxin affectability to antibiotics6,7,8.
The goal of this study is to look into the most common efflux pump genes from five different classes in K. Pneumoniae.
Bacterial Isolates Identification:
Fifty K. pneumoniae isolates were collected from patient with cystitis. First screening on MacConkey and EMB agar. Confirmation of E. coli was done via PCR using primer pairs of ptyr B: Forward primer: (GGCTGTACTACAACGATGAC), Reverse primer: (TTGAGCAGGTAATCCACTTTG) to give 931bp product at annealing temperature that was 56.5°C9.
Susceptibility of 50 UPEC isolates to 26 antibiotics was determined DDM based on the laboratory and clinical standards institute CLSI, 201910. In addition, the activation of isolates has been carried out with the use of nutrient broth at a temperature of 37 Celsius for 18 hrs and the growth was adjusted to 0.5 McFarland’s standard 1.5×108 CFU/mL), after that spread on Mueller Hinton agar MHA) with a cotton swab. Antibiotic discs have been placed on MHA, pressed down gently for ensuring complete contact with the agar inoculated with bacteria, and after that incubated for 18–20 h at 37°C and then inhibition zone diameter in mm was recorded. Interpretation of results as a sensitive or resist was achieved according to the CLSI, 201910.
G-Spin Genomic DNA Extraction Kit for bacteria) are designed isolation of genomic DNA from various sample sources, such as frozen or fresh animal cells and Gram-negative bacteria. Conventional PCR was used to amplify the 19 genes of efflux pumps using specific primer pairs Table 1). The PCR condition is illustrated in Table 2 for the PCR mixture of 20μl consisted of 5μl of Maxime PCR Premix kit i-Taq) Intronbio/Korea), 2.5 μl of forward primer 10pmole/μl), 2.5μl of reverse primer 10pmole/μl), 5μl) of target DNA, and 5μl of nuclease-free water New Biolabs/US.
Table 1: Oligonucleotide sequence and PCR conditions
|
Efflux pump Class |
Gene |
Sequence |
Product bp |
Annealing Temp |
|
RND |
AcrA-F |
ATCACCTTTCGCACTGTCGT |
256 |
58.3 °C |
|
AcrA-R |
CGACAAACAGGCCCAACAAG |
|||
|
AcrB-F |
CATAAACACGCCCTGGTCCT |
|||
|
AcrB-R |
GCTACCCGTAAGTCGATGGG |
432 |
60.3 ºC |
|
|
AcrF-F |
ATCCTCGCCGCTTTTGGTTA |
|||
|
AcrF-R |
AACACTTTTTGCGTCCGCTC |
626 |
57.2ºC |
|
|
AcrE-F |
CGCTGCAATTCTCCGATGTG |
|||
|
AcrE-R |
GCAGTATCTGCGGGGGTATC |
376 |
60.3 ºC |
|
|
AcrD-F |
GCCGTGCAGCAAGTACAAAA |
|||
|
AcrD-R |
CTGGTGTTTGCAGCAGTGAC |
424 |
58.3 °C |
|
|
MFS |
mdfA-F |
TTCGATGACCGCGTATCTGG |
206 |
59.3 °C |
|
mdfA-R |
CAGCGCCAATGAAACAGAGG |
|||
|
EmrD-F |
ACGTTAATGTGGCAGTCGGT |
|||
|
EmrD-R |
ACGCCGGAACCAATGTTTTG |
233 |
57.2 °C |
|
|
emrA-F |
CGCTGGAGCGTACTCGTATT |
|||
|
emrA-R |
ATTTTGCGCTGGAAGCAGTG |
287 |
58.3 °C |
|
|
emrB-F |
CTGCGCCGGTAGGGATTATT |
|||
|
emrB-R |
ATCCCAAGCCCTTCCAGTTG |
436 |
59.3 °C |
|
|
EmrE-F |
ACACGGTTATGGCCATCTGT |
|||
|
EmrE-R |
ATGTGGTGTGCTTCGTGACA |
249 |
57.2 °C |
|
|
YnfA-F |
CGCACCCGTCCAGTCATAAA |
|||
|
YnfA-F |
ATGCTTTCTGCCCTGGTTGT |
220 |
58.3 °C |
|
|
TehA-F |
TTGCCCGACTCATACGCTTT |
|||
|
SMR |
TehA-R |
CGCCATAATCCCGCAGTTTG |
208 |
58.3 °C |
|
MacA-F |
GCACAACAAGCACCGAACAT |
|||
|
MacA-R |
CATATCCAGCCGCAGCAAAC |
255 |
58.3 °C |
|
|
MacB-F |
GCGTGAGCGGCGATTATTTT |
|||
|
MacB-R |
AAACGCGTGAGTTGCTGTTC |
364 |
57.2 °C |
|
|
MdlA-F |
GCGCGTATTGATGCTCGTTT |
|||
|
MdlA-R |
AGCATCTGACCGGGTTTCAG |
383 |
58.3 °C |
|
|
MdlB-F |
GTTACGCCAGCCATTAAGCG |
|||
|
MdlB-R |
TCACCATTACCACCAGCACC |
727 |
59.3 °C |
|
|
ABC |
MdtK-F |
CTCTTTGGTCACGGACTGCT |
350 |
59.3 °C |
|
MdtK-R |
TTCACCGGGATGTTCACCAG |
|||
|
DinF-F |
TTGGTCTGCTAATGGTGCGT |
|||
|
MATE |
DinF-R |
ATGATGTGTTCCCCAGCCAG |
400 |
58.3 °C |
|
TolC-F |
CGATCGTGATGCTGCCTTTG |
|||
|
OM adapter |
TolC-R |
GGTTGCGTTTTTCGGCTTCT |
596 |
58.3 °C |
Antibiotic Susceptibility Test:
The antibiotic susceptibility test was performed based on CLSI-2019 by means of DDM for 26 antibiotics and the results revealed that, all isolates were high resist to ceftazidime 98%), Amoxicillin 92%), cefotaxime 92%), ceftriaxone 92%), cefixime 84%), cefepime 80%). Less resistance was displayed to streptomycin 78%), trimethoprime 76%), nitrofuraniton 58%), Aztreonam 58%) Kanamycin 50%). Low resistance was exhibited to rest of antibiotics: cefoxitin 46%), Gentamycine 40%), Tobramycine 44%), Ciprofloxacine 28%), Azithromycin 24%), Doxycycline 20%), peperacillin 16%), Nalidixic acid 16%), Imipenem 12%), Amikacine 10%), Levofloxacine 10%), ofloxacin 8%), Meropenem 8%), Netilamicin 4%), while all isolates were sensitive to Netilmicin and ofloxacine (Figure 1).
Figure 1: Antibiotic resistance of K. pneumoniae for 26 antibiotics
Concern antibiotic resistance patterns PDR, XDR and MDR), the results indicated that 510%) isolates were non-MDR while MDR compile 4590%) distributed as 24%), 48%), 1020%), 1122%), 1428%) and 48%) for MDR-8 classes, -7 classes, -6 classes, -5 classeses, -4 classes and -3 classes respectively (Figure 2)
Figure 2: Resistance patterns among K. pneumoniae isolate
The highest coexisted resistance phenotypes for K. pneumoniae distributed as: 714%) for B-lactam/Monobacatam/Aminoglycosides/Sulfa/Nitrofuran resistance, (714%) for B- lactam/Fluroquinolone/ Aminoglycosides/Sulfa/Nitrofuran resistance (4/ 8%) for B- lactam/AminoglycosideTetracycline/Sulf/Nitrofuran /Macrolide’s resistance (Table2)
Table 2: Phenotype of coexisted antibiotic resistance among K. pneumoniae isolates
|
Phenotype |
Resistance Pattern |
No. |
% |
|
B-Lactam/FLOURO/CARBA/MONO/AMINO/NITRO/MACRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/AMINO/TETRA/SULFA/NITRO/MACRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/MONO/AMINO/TETRA/NITRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/MONO/AMINO/TETRA/SULFA |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/CARBA/MONO/AMINO/SULFA |
MDR |
2 |
4 |
|
B-Lactam/FLOURO/MONO/AMINO/SULFA/MACRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/MONO/AMINO/SULFA/NITRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/AMINO/TETRA/SULFA |
MDR |
1 |
2 |
|
B-Lactam/AMINO/NITRO/MACRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/AMINO/NITRO |
MDR |
1 |
2 |
|
B-Lactam/CARBA/AMINO/MACRO |
MDR |
1 |
2 |
|
B-Lactam/CARBA/AMINO/NITRO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/MONO/AMINO |
MDR |
1 |
2 |
|
B-Lactam/FLOURO/AMINO/SULFA |
MDR |
1 |
2 |
|
B-Lactam/AMINO/SULFA/NITRO |
MDR |
3 |
6 |
|
B-Lactam/MONO/AMINO/NITRO |
MDR |
2 |
4 |
|
B-Lactam/FLOURO/AMINO/NITRO |
MDR |
1 |
2 |
|
B-Lactam/AMINO/SULFA |
MDR |
2 |
4 |
|
B-Lactam/FLOURO/AMINO |
MDR |
1 |
2 |
|
B-Lactam/AMINO/NITRO |
MDR |
5 |
10 |
|
B-Lactam/SULFA/NITRO |
MDR |
1 |
2 |
|
B-Lactam/AMINO/SULFA |
MDR |
1 |
2 |
|
B-Lactam/AMINO |
MDR |
8 |
16 |
|
B-Lactam/FLOURO |
non-MDR |
1 |
2 |
|
B-Lactam/Tetracyclin |
non-MDR |
1 |
2 |
|
B-Lactam |
non-MDR |
9 |
18 |
|
|
|
50 |
100 |
Molecular Detection of Efflux Pumps for K. pneumoniae:
Results of molecular investigation of efflux pumps in K pneumoniae revealed that class RND AcrAB-TolC, AcrAD-TolC and AcrFE-TolC genes were distributed as follow: acrA 4896%), acrB 4488%), acrD 46 92%), acrF 3264%), acrE 4692%) and tolC 50100%). Three class MFS pumps EmrAB-TolC, EmrD and MdfA) were also investigated for K. pneumoniae and the results: emrA 4896%), emrB 4998%), emrD 50100%) and mdfA 50100%). Three class SMR pumps EmrE, YnfA and TehA) genes were distributed as follow: emrE 3570%), ynfA 3366%) and tehA 3876%). Two class ABC pumps MacAB-TolC and MdlAB-TolC) genes were investigated for K. pneumoniae and the results: macA 3876%), macB 4896%), mdlA 3876%) and mdlB 50100%). Two MATE pumps MdtK and DinF) genes were studies and the results revealed that: mdtK and dinF genes were present 50100%) and 4386%) respectively in K. pneumoniae isolates (Figure 3)
A
B
C
D
E
F
G
H
Figure 3: Distribution of efflux pumps genes among K. pneumonia isolates A) AcrABTolC, B) AcrAD-TolC, C) EmrAB-TolC, D) AcrFE-TolC, E) EmrE,YnfA, TehA, F) MdfA and EmrD, G) MacAB-TolC, H) MdlAB-TolC, I) Mdtk and DinF
Coexisted Genotypes of Efflux Pumps for UPEC:
Concern results of coexisted pumps in same K. pneumoniae isolates the results showed that, the highest genotypes were: 816%) for genotype AcrAB-TolC/ AcrAD-TolC/AcrFE-TolC/MdfA/EmrD/EmrAB- TolC/ EmrE/YnfA/TehA/MacAB-TolC/MdlAB-TolC/ Mdtk/ DinF, 816%) for genotype AcrAB-TolC/AcrAD-TolC/ MdfA/EmrD/EmrAB-TolC/EmrE/YnfA/TehA/ MacAB-TolC/ MdlAB-TolC/ Mdtk/ DinF (Table3)
Table 3: Genotypes of efflux pump among K. pneumoniae
|
Genotype |
No. |
% |
|
AcrAB TolC/ AcrAD TolC/ AcrFE TolC/ MdfA/ EmrD/ EmrAB TolC/ EmrE/ YnfA/ TehA/ MacAB TolC/ MdlAB TolC/ Mdtk/ DinF |
32 |
64
|
|
AcrAB TolC/ AcrAD TolC/ AcrFE TolC/ MdfA/ EmrD/ EmrAB TolC/ YnfA/ TehA/ MacAB TolC/ MdlAB TolC/ Mdtk/ DinF |
1
|
2
|
|
AcrAB TolC/ AcrAD TolC/ MdfA/ EmrD/ EmrAB TolC/ EmrE/ YnfA/TehA/ MacAB TolC/ MdlAB TolC/ Mdtk/ DinF |
16
|
32
|
|
AcrAB TolC/ AcrAD TolC/ MdfA/ EmrD/ EmrAB TolC/ EmrE/ YnfA/MacAB TolC/ MdlAB TolC/ Mdtk/ DinF |
1
|
2
|
Biofilm Formation for K. pneumonia:
Results of biofilm formation revealed that 100% of isolates were biofilm former while 0% were non-biofilm. 40% was weak biofilm, 44% was moderate and 16% was strong biofilm former (figure 4).
Figure 4: Biofilm Formation patterns
In immunocompromised patients, like patients with diabetes and cancer and in transplant recipients, UTI with extensively ERKp) is a difficult infectious complication. Antibiotics' efficacy in treating UTIs is decreasing. There strong association between resistance to those 3 antibiotics and presence of 5 classes’ efflux pump genes. Multidrug efflux pumps are of high importance in the resistance to various antibiotic classes 11,12,13, the acridine resistance complex of E. coli, is the most well-studied RND transporter. An outer-membrane channel TolC, inner-membrane transporter AcrB, and a periplasmic protein AcrA make up this tripartite complex14,15. The most effective drug efflux pump E. coli's AcrAB works with TolC to extrude a wide variety of antimicrobial compounds from the cell, including antibiotics, dyes, detergents, and organic solvents16,17.
Chetri et al 201818 showed Overexpression of AcrEFTolC was found in 13 E. coli isolates that were also resistant to quinolones and carbapenems (18). The first being that EmrAB is very active at effluxing these antibiotics, so its deletion resulted in measurable MIC reductions19,20 EmrD belongs to the multidrug resistance exporter family, which is part of the main facilitator superfamily MFS EmrE21,22, a member of the small multidrug resistance SMR) protein family, uses secondary active antiport to transport medicines across the PM in exchange for protons23,24,25. Antibiotic resistance to penicillins and cephalosporins is also thought to grow in ynfA-expressing E. coli26.
MacA is a periplasmic membrane fusion protein that activates the operation of the MacB transporter and connects it to the outer membrane channel TolC in this complex27,28. The AcrAB and mdtK complexes are the most well-studied efflux pumps in K. pneumonia29,30 This group of bacteria's biofilm-forming capacity leads them to stick together and get embedded in a matrix of extracellular polymeric substance known as exopolysaccharides31,32,33. This generates a protective environment that makes antibiotic penetration more difficult and protects against insults like dehydration and food scarcity34,35.
The current study concludes that, all efflux pumps may be highly associated with resistance to ceftazidime, Amoxicillin, cefotaxime, ceftriaxone, cefixime, cefepime and moderately associated with to streptomycin, trimethoprime, nitrofuraniton, Aztreonam, Kanamycin and may be unrelated to resistance of other studied antibiotics or the concentration of theses antibiotics inadequate to induce the expression of these pumps. Additionally, biofilm formation was highly related to presence of studies pumps.
It is my pleasure to thankful the head of Biology department and advanced microbiology laboratory at college of science, university of Babylon for their permission and facilitate the work at their labs. Also many thanks to Assistant Prof. Dr. Noor S.K. Al-Khafaji for their assistant in PCR work.
Informed consent was obtained from all human adult participants or parents or legal guardians of minors. The project was approved by scientific committee and Bioethics committee under project no. 325 at 29 December 2020.
All authors declare that, the is no conflict of interest
The project was funded by authors themselves
1. Levison ME, Kaye D. Treatment of complicated urinary tract infections with an emphasis on drug-resistant gram-negative uropathogens. Curr Infect Dis Rep. 2013; 152): 109-15. doi: 10.1007/s11908-013-0315-7, PMID 23378123.
2. Kumar MS, Arunagirinathan N, Ravikumar M. Antibiotic susceptibility profile of extended spectrum β-lactamase producing Escherichia coli, Klebsiella pneumoniae and Klebsiella oxytoca from Urinary tract infections. Research Journal of Pharmacy and Technology. 2021; 14(8):4425-8.
3. Samer A. MH. Al-Hilali, Zainab Jaber Hadi, Kreem G. Aljayashi. Prevalence of Plasmid-mediated quinolone resistance genes among Ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from clinical isolates in Najaf, Iraq. Research Journal of Pharmacy and Technology. 2021; 14(4):1966-2.
4. Hooton TM. Clinical practice. Uncomplicated urinary tract infection. N Engl J Med. 2012; 366(11): 1028-1037. doi: 10.1056/NEJMcp1104429, PMID 22417256.
5. Bao J, Wu N, Zeng Y, Chen L, et al. Non- active antibiotic and bacteriophage synergism to successfully treat recurrent urinary tract infection caused by extensively drug-resistant Klebsiella pneumoniae. Emerg Microbes Infect. 2020; 9(1): 771-774. doi: 10.1080/22221751.2020.1747950,
6. Anes J, McCusker MP, Fanning S, Martins M. The ins and outs of RND efflux pumps in Escherichia coli. Front Microbiol. 2015; 6: 587. doi: 10.3389/fmicb.2015.00587.
7. Neupane S, Pant ND, Khatiwada S, Chaudhary R, Banjara MR. Correlation between biofilm formation and resistance toward different commonly used antibiotics along with extended spectrum beta lactamase production in uropathogenic Escherichia coli isolated from the patients suspected of urinary tract infections visiting Shree Birendra Hospital, Chhauni, Kathmandu, Nepal. Antimicrob Resist Infect Control. 2016; 5(1): 1-5.
8. Shaymaa Husham Ahmed, Rand R. Hafidh. The Isolation of specifically lytic phages along with their extracted endolysins as antibacterial agents to MDR Enterococcus faecalis. Research Journal of Pharmacy and Technology. 2021; 14(9):4547-4.
9. Jeong ES, Lee KS, Heo SH, Seo JH, Choi YK. Rapid identification of Klebsiella pneumoniae, Corynebacterium kutscheri, and Streptococcus pneumoniae using triplex polymerase chain reaction in rodents. Exp Anim. 2013;62(1):35-40. doi: 10.1538/expanim.62.35.
10. https://clsi.org/
11. Helaly GF, Shawky S, Amer R, El Sawaf G, El Kholy MA. Expression of Acrab efflux pump and role of mefloquine as efflux pump inhibitor in MDR E. coli. Am J Infect Dis. 2016; 4(1): 6-13. doi: 10.12691/ajidm-4-1-2.
12. Prasanthi Boddu, Vijaya Ratna Jayanti. Glyceryl Monooleate Functionalized Matrix with an Inter Polyelectrolyte Complex System for the Management of Drug Resistance in Tuberculosis. Research J. Pharm. and Tech. 2020; 13(10):4839-4850.
13. Yasufuku T, Shigemura K, Shirakawa T, Matsumoto M, et al. Correlation of overexpression of efflux pump genes with antibiotic resistance in Escherichia coli Strains clinically isolated from urinary tract infection patients. J Clin Microbiol. 2011; 49(1): 189-194. doi: 10.1128/JCM.00827-10.
14. Mousa JJ, Bruner SD. Structural and mechanistic diversity of multidrug transporters. Nat Prod Rep. 2016; 33(11): 1255-1267. doi: 10.1039/c6np00006a.
15. Nikaido H, Zgurskaya HI. AcrAB and related multidrug efflux pumps of Escherichia coli. J Mol Microbiol Biotechnol. 2001; 3(2): 215-218.
16. Ma D, Cook DN, Alberti M, Pon NG, et al. Molecular cloning and characterization of acrA and acrE genes of Escherichia coli. J Bacteriol. 1993; 1751(9): 6299-12313. doi: 10.1128/jb.175.19.6299-6313.1993.
17. T. Sharanya Nair, Meghana R, Shlini P.Antimicrobial Activity of the protein fraction obtained in the extraction of Curcumin. Asian J. Research Chem. 2019; 12(4):199-202.
18. Chetri S, Dolley A, Bhowmik D, Chanda DD, et al. Transcriptional response of AcrEF-TolC against fluoroquinolone and carbapenem in Escherichia coli of clinical origin. Indian J Med Microbiol. 2018; 36(4): 537-540. doi: 10.4103/ijmm.IJMM_18_308.
19. Heacock-Kang Y, Sun Z, Zarzycki-Siek J, Poonsuk K, McMillan IA, Chuanchuen R, Hoang TT. Two regulators, PA3898 and PA2100, modulate the Pseudomonas aeruginosa multidrug resistance MexAB-OprM and EmrAB efflux pumps and biofilm formation. Antimicrob Agents Chemother. 2018; 62(12): e01459-18 doi: 10.1128/AAC.01459-18.
20. Gurudharshini Natarajan, Madhumitha Muthusamy, Muthusaravanan Sivaramakrishnan, Perianayaki Periasamy, Poornimmashree A, Kumaravel Kandaswamy. A Big Picture on Antimicrobial Strategies then and now. Research J. Engineering and Tech. 2017; 8(4): 361-364.
21. Nikaido H. Multidrug resistance in bacteria. Annu Rev Biochem. 2009;78:119-46. doi: 10.1146/annurev.biochem.78.082907.145923, PMID 19231985.
22. Schweizer HP. Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: unanswered questions. Genet Mol Res. 2003;21):48-62. PMID 12917802.
23. Bay DC, Rommens KL, Turner RJ. Small multidrug resistance proteins: a multidrug transporter family that continues to grow. Biochim Biophys Acta. 2008;17789):1814-38. doi: 10.1016/j.bbamem.2007.08.015.
24. Jeya KR, VeeraPagu M. Screening for the Antimicrobial Activity of Lippia nodiflora Leaf Extract Against Selective Bacterial Population. Research J. Pharm. and Tech. 4(11): Nov. 2011; Page 1669-1672.
25. Schuldiner S. EmrE, a model for studying evolution and mechanism of ion-coupled transporters. Biochim Biophys Acta. 2009; 1794(5): 748-762. doi: 10.1016/j.bbapap.2008.12.018.
26. Hus N. ynfA, a novel Escherichia coli gene of the small multidrug resistance superfamily. University of Miami; 2005.
27. Modali SD, Zgurskaya HI. The periplasmic membrane proximal domain of MacA acts as a switch in stimulation of ATP hydrolysis by MacB transporter. Mol Microbiol. 2011; 81(4): 937-951. doi: 10.1111/j.1365-2958.2011.07744.x.
28. S. Niveditha, S.S.M. Umamageswari, D. Aruna, M. Kalyani. Study of Hand Carriage of Multi drug resistant bacteria using Glove Juice Technique in Health Care Workers. Research J. Pharm. and Tech. 2021; 14(2):650-656.
29. Wasfi R, Elkhatib WF, Ashour HM. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Sci Rep. 2016: 6(1): 38929. doi: 10.1038/srep38929.
30. Taghadosi R, Shakibaie MR, Masoumi S. Biochemical detection of N-Acyl homoserine lactone from biofilm-forming uropathogenic Escherichia coli isolated from urinary tract infection samples. Rep Biochem Mol Biol. 2015; 3(2): 56-61.
31. Mustafa Jawad, Kadhim Hashim, Abbas Mahmood. Prevalence of Anti-Viral Drug Resistance Chronic Hepatitis B patients (CHB) in Iraq. Research J. Pharm. and Tech 2018; 11(8): 3503-3508.
32. Jafarzadeh Samani R, Tajbakhsh E, Momtaz H, Kabiri Samani M. Prevalence of Virulence Genes and Antibiotic Resistance Pattern in Enterococcus Faecalis Isolated from Urinary Tract Infection in Shahrekord, Iran. Rep Biochem Mol Biol. 2021; 10(1): 50-59. doi:10.52547/rbmb.10.1.50
33. Prakash B, Veeregowda BM, Krishnappa G. Biofilms: a survival strategy of bacteria. Curr Sci. 2003: 1299-307.
34. Hisham A. Abbas, Ashraf A. Kadry, Ghada H. Shaker, Reham M. Goda. Resistance of Escherichia coli and Klebsiella pneumoniae isolated from different Sources to β-lactam Antibiotics. Research J. Pharm. and Tech. 2017; 10(2): 589-591.
35. Naparstek L, Carmeli Y, Navon-Venezia S, Banin E. Biofilm formation and susceptibility to gentamicin and colistin of extremely drug-resistant KPC-producing Klebsiella pneumoniae. J Antimicrob Chemother. 2014; 69(4): 1027-1034. doi: 10.1093/jac/dkt487.
Received on 03.12.2021 Modified on 30.01.2022
Accepted on 28.02.2022 © RJPT All right reserved
Research J. Pharm. and Tech 2022; 15(10):4559-4564.
DOI: 10.52711/0974-360X.2022.00765